Educational guide
A novel peptide-based strategy to enhance GBA1 ...
Introduction Parkinson’s disease (PD) is a progressive neurodegenerative disorder characterized by the selective degeneration of dopaminergic neurons in the substantia nigra and the pathological accumulation of α-synuclein aggregates 1 . Among the lysosomal ge
This guide cannot diagnose a condition or recommend a personal treatment plan. Discuss medical questions with a qualified professional.
Introduction
Parkinson’s disease (PD) is a progressive neurodegenerative disorder characterized by the selective degeneration of dopaminergic neurons in the substantia nigra and the pathological accumulation of α-synuclein aggregates1. Among the lysosomal genes associated with PD, GBA1 gene, which encodes the lysosomal hydrolase glucocerebrosidase (GCase), has emerged as one of the most significant genetic risk factors2. Loss-of-function mutations in GBA1 lead to reduced GCase activity, resulting in the accumulation of its substrates, including glucosylceramide (GlcCer), which has been shown to promote α-synuclein aggregation and neurotoxicity3,4,5. Notably, GCase and α-synuclein are proposed to exist in a bidirectional pathogenic loop, where reduced GCase activity accelerates α-synuclein accumulation, which in turn further impairs GCase trafficking and function6,7,8.
Reduced GCase activity is not limited to patients with GBA1 mutations. It is also frequently observed in idiopathic PD patients8 and in aged individuals without genetic predisposition9, suggesting that GCase impairment plays a broader role across both sporadic and familial forms of PD10. At the cellular level, GCase deficiency compromises lysosomal degradation, leading to the accumulation of misfolded proteins, impaired autophagy, mitochondrial dysfunction, and neuroinflammation11,12,13. Clinically, PD patients harboring GBA1 mutations often present with earlier onset14, more rapid disease progression15, and higher rates of cognitive decline compared to non-carriers2,16. In contrast, restoration of GCase activity in preclinical models has been shown to enhance lysosomal function, reduce α-synuclein pathology, alleviate inflammatory responses, and support neuronal survival17,18,19,20. These cumulative findings establish GCase as a critical regulator of neuronal homeostasis and a promising target for therapeutic intervention. Consequently, restoring or enhancing GCase activity has emerged as a promising therapeutic strategy to alleviate PD.
Several approaches have been investigated to modulate GCase activity21. Enzyme replacement therapy (ERT) is efficacious for systemic symptoms in Gaucher disease but is ineffective in PD due to its inability to cross the blood–brain barrier (BBB)22,23,24,25. Chemical chaperones such as ambroxol have been shown to enhance GCase folding and trafficking to the lysosome, with early-phase clinical studies demonstrating increased enzyme activity and reduced substrate accumulation19,22,26,27,28,29,30. However, concerns regarding off-target effects and long-term efficacy remain. Gene therapy using AAV-mediated delivery of wild-type GBA1 has advanced to clinical trials and shows promise in elevating GCase levels in the CNS31,32,33. However, gene therapy approaches are irreversible, potentially immunogenic, and logistically complex. Additional approaches, including GCase activators30,34,35, substrate reduction therapies (SRTs) targeting GlcCer synthesis36,37,38,39,40, and small-molecule modulators41, are under investigation but face limitations in BBB penetration, specificity, and long-term efficacy42,43. In contrast, cell-penetrating peptides (CPPs) offer a novel and versatile alternative. These short peptides can translocate across cellular membranes in a receptor-independent manner, facilitating intracellular delivery of biologically active cargo44. Their ability to evade endosomal sequestration and selectively reach subcellular compartments such as lysosomes makes them attractive for targeting intracellular enzymes like GCase. Furthermore, CPPs can be chemically tailored to improve pharmacokinetic profiles, BBB permeability, and therapeutic precision, which attributes essential for treating neurodegenerative diseases45.
In this study, we developed a luminescence-based reporter system using a HiBiT-tagged GCase knock-in (KI) HEK293T cell line, enabling real-time and quantitative assessment of endogenous GCase levels46,47. Using this system, we screened a library of CPPs derived from leech and identified hirunipin 4 as a lead candidate that significantly increased GCase protein levels and enzymatic activity. Subsequent validation in α-synuclein preformed fibrils (PFF)-induced cellular PD models demonstrated that hirunipin 4 reduced α-synuclein aggregation, restored lysosomal homeostasis, and improved neuronal viability. Mechanistic investigations further revealed that hirunipin 4 enhanced nuclear translocation of TFEB, a key transcriptional regulator of lysosomal biogenesis, and increased GCase protein stability. Collectively, our findings identify hirunipin 4 as a novel peptide-based modulator of GCase activity and offer a new therapeutic strategy for ameliorating lysosomal dysfunction in PD.
Results
Characterization of GBA1-HiBiT KI HEK293T cells for luminescent detection of endogenous GCase protein levels
To assess luminescence-based quantification of endogenous GCase protein levels, the HiBiT tag was inserted at the C-terminus of the GBA1 gene using CRISPR/Cas9-mediated homologous recombination in LgBiT-stably expressed HEK293T cells (Fig. 1A). The 11 amino acids HiBiT tag (1.3 kDa) allows for substrate-driven bioluminescent detection of HiBiT-tagged GCase protein levels, without any functional interference due to its small size (Fig. 1B). To confirm luminescence signal from GBA1 expression, the cells were transfected with TFEB, a transcription factor known to upregulate GBA1 expression through lysosomal biogenesis pathways48,49. In LgBiT-stably expressed HEK293T cells lacking the HiBiT tag, no bioluminescent signal was detected regardless of TFEB transfection or substrate addition. In contrast, GBA1-HiBiT KI HEK293T cells exhibited a marked increase in luminescence upon TFEB overexpression compared to controls (Fig. 1C), indicating functional integration of the GBA1 expression levels and luminescent readout capability. Western blot analysis further confirmed that GCase protein levels were elevated upon TFEB transfection in both LgBiT only and GBA1-HiBiT KI cells, compared to mock conditions (Fig. 1D and E). These results indicate that the luminescence signal observed in the GBA1-HiBiT KI cell line reflects the relative abundance of GCase protein and that the HiBiT tag does not interfere with GBA1 expression.
Fig. 1: Generation and validation of GBA1-HiBiT KI HEK293T cells for luminescent detection of GCase protein levels.A Illustration of CRISPR/Cas9-mediated knock-in strategy to tag the C-terminus of endogenous GCase with HiBiT in HEK293T cells. B Schematic diagram of luminescence detection via HiBiT–LgBiT complementation. C Quantification of bioluminescence signal in LgBiT-only and GBA1-HiBiT KI cells with or without TFEB transfection (n = 3). D Representative immunoblots of GCase and β-actin in LgBiT-only expressed and GBA1-HiBiT KI cells by TFEB overexpression. E Quantification of GCase protein levels normalized to β-actin (n = 5). Error bars represent mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Bonferroni post hoc test for multiple grouped comparison. *P < 0.05, **P < 0.01, ***P < 0.001. Illustrated images were generated from BioRender.com.
Screening of leech-derived cell-penetrating peptides for induction of GBA1 expression
To identify leech-derived peptides capable of enhancing GBA1 expression, a panel of 18 peptides (Table 1) was screened using the GBA1-HiBiT KI HEK293T cells. Each peptide was administered at a concentration of 1 µg/mL for 24 hours, and luminescence intensity was measured to assess changes in GCase protein levels. Among the tested peptides, three candidates, including peptides LP17, LP18, and LP19, exhibited an increase in luminescent signal compared to the untreated control (Fig. 2A). To further confirm these findings, the expression of GCase protein was examined by Western blot analysis following peptide treatment. Among the selected candidates, LP17 showed the most pronounced increase in GCase protein levels (Fig. 2B and C), supporting its potential role as a strong inducer of GBA1 expression.
Fig. 2: Screening of leech-derived CPPs and identification of LP17 as a GCase expression enhancer.A Bioluminescence screening of 18 leech-derived CPPs (1 μg/mL, 24 hours) in GBA1-HiBiT KI cells (n = 4). B Representative immunoblots of GCase and β-actin in HEK293T cells treated with selected peptides. C Quantification of GCase protein levels normalized to β-actin after 1 μg/mL of peptide treatment for 24 hours (n = 6). Error bars represent mean ± SEM. Statistical significance was determined using one-way ANOVA followed by Tukey’s test post hoc test for multiple comparison. *P < 0.05, **P < 0.01. n.s. not significant.
Table 1 List of the candidate cell-penetrating peptides (CPPs) identified from the medicinal leech genome assembly by in silico analysisHirunipin 4 treatment ameliorates pathological α-synuclein aggregation and neurotoxicity in PFF-treated neuronal cells
In the HiBiT reporter system-based screening, LP17, LP18, and LP19 exhibited an increase in GCase protein levels. Based on these results, we performed additional experiments to determine the optimal concentrations of these peptides for enhancing GCase expression in both SH-SY5Y cells (Supplementary Fig. S1). Based on the previously identified most promising candidate, LP17, the lowest effective concentrations were determined for use in subsequent experiments: 2 μg/mL for SH-SY5Y cells and 1 μg/mL for primary mouse neurons. In order to investigate the therapeutic effect of leech-derived peptides against α-synuclein PFF-induced pathological α-synuclein aggregation, the levels of phosphorylated α-synuclein at Ser129 (pS129) were monitored in the Triton X100-insoluble protein fraction from 5 μg/mL PFF-treated human SNCA gene overexpressed SH-SY5Y cells. After 24 hours peptide treatment, Western blot analysis of the insoluble fraction revealed that peptides LP17 and LP18 significantly reduced the levels of pS129 α-synuclein compared to the vehicle control (Fig. 3A and B). In SH-SY5Y cells, examination of the TX-soluble fraction blots showed that total α-synuclein levels were equivalent among SNCA transfected groups. These findings indicate that the observed changes in pS129 α-synuclein are attributable to pathological modifications rather than differences in total α-synuclein content (Supplementary Fig. S2A and B). In addition to cell line experiment, LP17 treatment resulted in the most substantial reduction in pS129 α-synuclein levels, while LP19 showed a modest decrease and LP18 exhibited minimal effect in PFF-treated primary cortical neurons (Fig. 3C and D). Total α-synuclein protein levels remained largely unchanged across all treatment groups (Fig. 3C and E), and endogenous α-synuclein levels were comparable across conditions (Supplementary Fig S2C and D). Moreover, PFF treatment increased pS129 α-synuclein signal by approximately 3-fold, whereas co-treatment with LP17 reduced this signal by about 30% (Fig. 3F and G). Hereafter we refer to LP17 as hirunipin 4, since LP17 has identified by fourth active leech Hirudo nipponia peptide after our previous study50. We predicted the tertiary structures of hirunipin 4 using the I-TASSER server. Hirunipin 4 had a long α-helix at the N-terminal region (Supplementary Fig. S3). Prior to functional assays, we confirmed the safety of hirunipin 4 by performing dose-response cell viability assays. The results showed no cytotoxicity at the concentrations used for subsequent experiments in both SH-SY5Y cells and primary mouse neurons (Supplementary Fig. S4). Lastly, we assessed whether hirunipin 4 could mitigate PFF-induced neurotoxicity. Cell viability was measured by AlamarBlue assay following 10 μg/mL PFF treatment with 1 μg/mL peptide for 2 weeks. Compared to the PFF-only group, which showed 50% viability, co-treatment with hirunipin 4 increased cell viability to approximately 75% (Fig. 3H). To complement the Alamar blue assay and address its limitations, we additionally evaluated cell viability in primary mouse neurons using propidium iodide (PI) staining. Consistent with the Alamar Blue assay results, PI staining revealed that hirunipin 4 co-treatment increased cell viability by approximately 50% compared to PFF treatment alone (Fig. 3I and J). Collectively, these data suggest that hirunipin 4 not only enhances GBA1 expression but also reduces pathological α-synuclein aggregation and improves neuronal cell viability, highlighting its therapeutic potential.
Fig. 3: Hirunipin 4 treatment reduces α-synuclein aggregation and improves neuronal viability.A Representative immunoblots of pS129 α-synuclein in TX-insoluble fractions from 5 μg/mL PFF-treated SH-SY5Y cells transfected with human SNCA-GFP expressing vector in the presence of 2 μg/mL leech-derived peptides. B Quantification of pS129 α-synuclein levels normalized to β-actin after 24 hours post-treatment (n = 5). C Representative immunoblots of pS129 α-synuclein and total α-synuclein in TX-insoluble fractions from 5 μg/mL PFF-treated primary cortical neurons with indicated leech-derived peptides. Quantification of pS129 α-synuclein (D) and total α-synuclein (E) protein levels normalized to β-actin at 14 days after PFF treatment (n = 3). F Representative immunofluorescence images of pS129 α-synuclein in primary neurons treated with 5 μg/mL PFFs with 1 μg/mL hirunipin 4. Scale bar represents 20 μm. G Quantification of pS129 α-synuclein immunoreactivity at 10 days after PFF treatment with or without hirunipin 4 co-treatment (n = 3). H Cell viability was determined by AlamarBlue assay after PFF and hirunipin 4 treatment for 2 weeks in primary neurons (n = 12). I Representative fluorescence images of primary cortical neurons stained with Hoechst 33342 (blue) and propidium iodide (PI, red) to assess cell death. Scale bar represents 20 μm. J PI-positive cells were quantified as a percentage of total Hoechst-positive nuclei (n = 12). Error bars represent mean ± SEM. Statistical significance was determined using one and two-way ANOVA followed by Tukey’s and Bonferroni post hoc test for multiple comparison. *P < 0.05, **P < 0.01, ***P < 0.001. n.s. not significant.
Hirunipin 4 treatment enhances lysosomal GCase activity and reduces GlcCer accumulation
Since hirunipin 4 increases GCase protein levels and mitigates PD-related α-synuclein pathology, we next evaluated whether hirunipin 4 also enhances GCase enzymatic activity, and whether this is accompanied by a reduction in GlcCer accumulation, a downstream consequence of GCase dysfunction. By immunofluorescence analysis, we found that GCase levels were modestly reduced in primary cortical neurons following PFF treatment. However, this reduction was alleviated in the hirunipin 4 co-treatment group, as shown by increased GCase signal intensity in lysosomes (Fig. 4A and B). Notably, hirunipin 4 alone also led to a detectable increase in GCase levels under PBS-treated group. To directly assess GCase enzymatic activity, lysosomal fractions were isolated and subjected to GCase activity assay. Consistent with the immunostaining results, GCase activity was decreased in the PFF-treated group, and this decrease was reversed by co-treatment with hirunipin 4. Furthermore, lysosomal GCase activity was also elevated in PBS-treated cells upon hirunipin 4 treatment (Fig. 4C). Moreover, we examined the levels of glucosylceramide (GlcCer), a lipid substrate that accumulates upon GCase deficiency. In the PFF-treated group, GlcCer levels were significantly increased, reflecting impaired GCase activity. However, co-treatment with hirunipin 4 markedly reduced GlcCer accumulation to levels comparable to those in PBS-treated controls (Fig. 4D and E). In the PBS-treated group, hirunipin 4 treatment also led to a mild but consistent reduction in GlcCer levels. To determine whether the effects observed in SH-SY5Y cells were reproducible in a more physiologically relevant system, we examined GlcCer accumulation in primary mouse cortical neurons (Fig. 4F and G). Consistent with the results obtained in SH-SY5Y cells, PFF treatment led to a marked increase in GlcCer levels in primary neurons. Notably, co-treatment with hirunipin 4 significantly reduced GlcCer accumulation compared to PFF treatment alone, indicating that the peptide exerts similar protective effects in both cellular models. Collectively, these data demonstrate that hirunipin 4 increases both GCase protein levels and functional activity, resulting in the clearance of GlcCer under PFF-induced pathological conditions.
Fig. 4: Hirunipin 4 restores GCase protein levels and activity against PFF treatment leading to reduction of GlcCer accumulation.A Representative immunofluorescence images of GCase and LAMP1 in SH-SY5Y cells treated with 5 μg/mL PFF in the presence of 2 μg/mL hirunipin 4. B Quantification of GCase intensity in PFF-treated SH-SY5Y cells after 24 hours (n = 3). C Quantification of lysosomal GCase enzymatic activity in PFF-treated SH-SY5Y with or without hirunipin 4 treatment (n = 6). D Representative immunofluorescence images of GlcCer in PFF-treated SH-SY5Y cells co-treated with 2 μg/mL hirunipin 4. E Quantifiaction of GlcCer levels relative to PBS with vehicle group (n = 3). F Representative immunofluorescence images of GlcCer in PFF-treated primary cortical mouse neurons co-treated with 1 μg/mL hirunipin 4. G Quantification of GlcCer levels relative to PBS with vehicle group (n = 4). Scale bars represent 20 μm. Error bars represent mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Bonferroni post hoc test for multiple group comparison. *P < 0.05, **P < 0.01, ***P < 0.001. n.s. not significant.
Hirunipin 4 peptide affects TFEB nuclear translocation and GCase protein stability
To investigate the underlying molecular mechanism that enhances GCase activity and reduces GlcCer accumulation by hirunipin 4 treatment, we examined whether the effect was due to increased transcriptional activation or post-translational stabilization of GCase. First, to assess transcriptional regulation of GBA1 gene via TFEB, SH-SY5Y cells were transfected with plasmid expressing EGFP-tagged TFEB. Nuclear localization of TFEB was monitored after 4 hours 2 μg/mL hirunipin 4 treatment. As a result, hirunipin 4 treatment resulted in a 1.7-fold increase in nuclear TFEB signal compared to the vehicle control (Fig. 5A and B). In addition, EGFP-TFEB expressed SH-SY5Y cells were fractionated via cytoplasmic and nuclear fractions. Consistently, nuclear TFEB levels were elevated in hirunipin 4-treated cells relative to controls, indicating enhanced nuclear translocation of TFEB under hirunipin 4 treatment conditions (Fig. 5C and D). To examine the nuclear translocation of endogenous TFEB, the same experimental procedure was performed using a TFEB-specific antibody (Fig. 5E and F). Similar to the results observed with TFEB overexpression, hirunipin 4 treatment promoted nuclear localization of TFEB. These results suggest that hirunipin 4 may increase GBA1 expression through TFEB-mediated transcriptional activation. However, no significant differences were observed in TFEB mRNA or protein levels between vehicle and hirunipin 4 treated groups (Fig. 5G-I). These results indicate that hirunipin 4 does not alter the overall abundance of TFEB, but rather enhances GBA1 expression by promoting TFEB nuclear translocation and subsequent transcriptional activation of GCase. Next, to determine whether hirunipin 4 also affects the protein stability of GCase, we performed cycloheximide (CHX) chasing assay (Fig. 5J and K). SH-SY5Y cells were treated with 100 μg/mL CHX, with or without hirunipin 4, and GCase protein levels were assessed indicated time. In the absence of hirunipin 4, GCase protein levels declined significantly by 9 hours after CHX treatment. However, co-treatment with hirunipin 4 preserved GCase levels up to 6 hours and delayed degradation at 9 hours, indicating enhanced protein stability in the presence of hirunipin 4. Taken together, these findings suggest that hirunipin 4 not only promotes TFEB-dependent transcriptional activation but may also contribute to post-translational stabilization of GCase protein. Collectively, our findings establish the efficacy of hirunipin 4 in enhancing GBA1 expression, restoring lysosomal enzyme activity, and reducing α-synuclein aggregation, thereby supporting its potential as a novel therapeutic approach for PD.
Fig. 5: Hirunipin 4 treatment enhances TFEB nuclear translocation and stabilizes GCase protein.A Immunocytochemistry showing TFEB-EGFP translocation to the nucleus at 4 hours after 2 μg/mL hirunipin 4 treatment. Scale bar represents 20 μm. B Quantification for the percentage of cells with nuclear TFEB signal (n = 3). C Representative immunoblots of TFEB in nuclear and cytoplasmic fractions with or without hirunipin 4 treatment. Hiru.4 refers to hirunipin 4. D Quantification for the relative ratio of nuclear TFEB levels (n = 3). E Representative immunoblots of endogenous TFEB in nuclear and cytoplasmic fractions with or without hirunipin 4 treatment. TFEB levels were detected using a specific anti-TFEB antibody. For cytoplasmic fraction samples, twice the amount of total protein was loaded compared to nuclear fractions. Therefore, β-actin was not included as a loading control. F Quantification for the relative ratio of nulcear TFEB levels (n = 3). Nuclear and cytoplasmic protein levels were respectively normalized to lamin B and α-tubulin. G Representative immunoblots of TFEB in total cell lysates prepared from cells treated with or without hirunipin 4. H Quantification of TFEB protein levels normalized to β-actin (n = 3). I Relative mRNA expression levels of TFEB in cells treated with hirunipin 4 or vehicle control, as determined by RT-qPCR. Data were normalized to GAPDH and are presented as fold change relative to the control group (n = 6). J CHX chasing assay of GCase protein degradation with or without 1 μg/mL hirunipin 4. Representative immunoblot of GCase in indicated times. K Quantification of GCase stability after 100 μg/mL CHX treatment (n = 3). Error bars represent mean ± SEM. Statistical significance was determined using unpaired two-tailed t-test and two-way ANOVA followed by Bonferroni post hoc test for multiple comparison. *P < 0.05.
Discussion
PD is a complex neurodegenerative disorder in which lysosomal dysfunction plays a central pathogenic role51,52,53,54. Among lysosomal enzymes, GCase has been extensively studied due to its dual involvement in both genetic and sporadic forms of PD2,51,55. Accumulating evidence suggested that GBA1 deficiency impairs lysosomal degradation and contributes to the accumulation of α-synuclein, a hallmark of PD pathology3,4,5. Importantly, a bidirectional feedback loop between GCase and α-synuclein has been proposed, whereby reduced GCase activity promotes α-synuclein aggregation, which in turn disrupts GCase trafficking and its lysosomal function6. Despite the well-established role of GCase dysfunction in the pathogenesis of PD, effective pharmacological strategies to enhance endogenous GCase levels and activity remain limited. We aimed to establish a high-resolution, luminescence-based platform capable of quantifying endogenous GCase expression dynamically and sensitively46,47. Using this system, our aim was to identify novel peptide-based modulators of GCase that could serve as a potential therapeutic approach for restoring lysosomal function and attenuating α-synuclein pathology in PD.
To address this purpose, we developed a high-throughput luminescence-based reporter system using a HiBiT-tagged GCase knock-in HEK293T cell line. This platform enabled real-time, quantitative monitoring of endogenous GBA1 expression and provided a robust screening strategy for identifying bioactive peptides that modulate GCase levels. From a library of CPPs derived from medicinal leech (Hirudo nipponia) sequences, we identified hirunipin 4 as a potent candidate. Leech-derived peptides, including recently characterized hirunipins, have demonstrated broad bioactivity profiles such as antimicrobial, antibiofilm, and anti-inflammatory effects with minimal cytotoxicity50. These properties, combined with their cell-permeable ability, make them attractive platforms for intracellular enzyme modulation in the context of neurodegeneration.
Our results demonstrated that hirunipin 4, one of the screened leech-derived CPPs, significantly enhances GCase expression and enzymatic activity, as determined by HiBiT luminescence assay and Western blot analysis (Figs. 2 and 4). Mechanistically, hirunipin 4 promoted TFEB nuclear translocation, a key regulator of lysosomal gene transcription56,57, leading to increased GBA1 expression (Fig. 5). In parallel, cycloheximide chase assay showed that hirunipin 4 prolonged GCase protein half-life, suggesting increased post-translational stabilization (Fig. 5). This dual mechanism, transcriptional activation via TFEB and enhanced protein stability, accounts for upregulation of GCase observed in our system. Moreover, hirunipin 4 treatment reduced insoluble pS129-α-synuclein levels in SH-SY5Y cells, and similar effects were observed in PFF-treated primary cortical neurons (Figs. 3 and 4). Furthermore, hirunipin 4 attenuated PFF-induced GCase activity loss and GlcCer accumulation, while improving neuronal viability, collectively supporting its neuroprotective efficacy (Figs. 3 and 4).
A major strength of this study lies in the integration of HiBiT-based reporter platform with peptide-based screening. Unlike irreversible genetic manipulations or small molecules with limited BBB permeability, CPPs offer a reversible and chemically tunable platform that can penetrate the blood–brain barrier and access subcellular compartments such as lysosomes44,45. The leech-derived origin of hirunipin 4 also introduces structural diversity and the potential for multifunctional therapeutic effects. However, further investigation is warranted to elucidate its mechanism of uptake, trafficking, and interaction with GCase regulatory pathways.
Despite the promising results, this study has limitations. First, the experiments were limited to in vitro models, and the in vivo pharmacokinetics, bioavailability, and blood–brain barrier permeability of hirunipin 4 remain to be determined. Second, although we explored the possibility of direct interactions between hirunipin 4 and either GCase or TFEB through molecular docking simulations, no definitive or compelling evidence of binding was observed. These in silico results suggest that any potential interaction may be weak or structurally constrained. However, given the predictive nature and inherent limitations of such approaches, particularly when applied to long, polybasic peptides, the results should be interpreted with caution and require experimental validation. At present, the precise mechanism by which hirunipin 4 enhances TFEB translocation and GCase stabilization warrants further mechanistic studies, including whether it acts via lysosomal stress signaling, mTORC1 inhibition, or direct protein–protein interactions58,59,60. Third, long-term effects and off-target consequences of repeated peptide exposure have not yet been evaluated. Addressing these questions will be essential for advancing hirunipin 4 as a preclinical candidate.
In conclusion, our findings identify hirunipin 4 as a novel peptide capable of enhancing GCase function and mitigating α-synuclein pathology in PFF-induced cellular PD models. By targeting both transcriptional and post-translational regulation of GCase, hirunipin 4 holds promise as a versatile and non-genome-integrating therapeutic candidate. These results support the further development of CPP-based strategies for modulating lysosomal enzyme function and lay the groundwork for in vivo validation and translational application in PD.
Methods
Generation of GBA1-HiBiT KI HEK293T cells
HEK293T cells were transfected twice with an LgBiT expression construct using the Neon™ Transfection System (Thermo Fisher Scientific) according to the manufacturer’s protocol. Following transfection, cells were cultured under selective conditions and subjected to single-cell sorting to establish clonal populations. To verify successful and stable integration of LgBiT, multiple clones were transiently transfected with a HiBiT-tagged vector. Luminescence was measured using the Nano-Glo® Dual-Luciferase® Reporter Assay System (Promega) to assess NanoLuc signal output. Clones exhibiting strong and stable luminescence signals were selected for subsequent experiments. To genetically insert the HiBiT tag, a small, 11-amino-acid epitope capable of forming a functional luciferase when complemented by LgBiT, at the human GBA1 locus, CRISPR-Cas9 guide RNAs (gRNAs) were designed using the CRISPR RGEN Tools Cas-Designer (http://www.rgenome.net/cas-designer/). Based on the genomic sequence of GBA1, two gRNA target sites, 5’-ACTCCATTCACACCTACCTGTGG-3’ and 5’-TCACTGGCGACGCCACAGGTAGG-3’, were selected and individually cloned into the PX458 plasmid (Addgene plasmid, Cat#48138), which expresses SpCas9 and GFP61. The donor vector for homology-directed repair (HDR) was constructed by inserting the HiBiT tag sequence (GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC) between ~800 bp homology arms corresponding to the GBA1 locus. The left homology arm (LHA) and right homology arm (RHA) were PCR-amplified from human genomic DNA and incorporated into a plasmid backbone via Gibson assembly. HEK293T cells stably expressing LgBiT were seeded in 6-well plates and co-transfected with 1 µg of PX458-gRNA plasmid each and 2 µg of donor plasmid using Lipofectamine 3000 (Thermo Fisher Scientific), following the manufacturer’s instructions. 72 hours post-transfection, cells were subjected to single-cell cloning by limiting dilution. Clonal populations were expanded and screened for HiBiT expression using the Nano-Glo HiBiT Lytic Detection System (Promega). Luminescent clones were further validated by genomic DNA extraction followed by PCR and Sanger sequencing to confirm the site-specific integration of the HiBiT tag into the GBA1 locus.
Preparation of leech peptide
For analysis in this project, we chose the previously studied Hirudo LP17 peptide50. A total of 18 putative anti-microbial peptides used in the experiments were synthesized by Dandicure, Ltd. via Fmoc-based solid-phase peptide synthesis. The mass of the purified peptides was determined using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectroscopy. The amino acid sequence of all peptides is presented in Table 1. The corresponding mass data for LP20, LP21, LP22, and LP23 are provided in Supplementary Fig. S5, while the mass data for the remaining leech-derived peptides have been reported in a previous study50. The calculated and measured peptide masses agreed, confirming the accurate synthesis of all 18 peptides. Structural modeling of the LP17 peptide was performed using the I-TASSER server (https://zhanggroup.org/I-TASSER/), enabling visualization of its putative conformation.
Cell culture
SH-SY5Y and HEK293T cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with GlutaMAX™ (Gibco), 10% fetal bovine serum (FBS) (Gibco), and 100 U/mL penicillin-streptomycin (Thermo Fisher Scientific) in a humidified incubator at 37 °C with 5% CO₂. Cells were plated onto 6-well plates for Western blotting (1.0 × 106 cells/mL) or Poly-D-Lysine coated 12-mm coverslips (Marienfeld Superior) for immunocytochemistry (5.0 × 105 cells/mL). For transfection, pcDNA-hSNCA-GFP and pEGFP-N1-TFEB constructs were introduced into SH-SY5Y cells using PolyJet™ In Vitro DNA Transfection Reagent (SignaGen) following the manufacturer’s instructions. Peptides were pre-treated at 2 μg/mL one hour before 5 μg/ml PFF addition. Then, the cells were harvested one day after treatment. The experimental conditions for PFF concentration and treatment duration were based on preliminary optimization experiments and previously validated protocols to induce pathological α-synuclein aggregation. The PFF concentration settings were set as per the following previous study62.
Primary neuron culture
Primary cortical neuronal cultures were obtained from embryonic day 15 wild-type mice. Cells were seeded in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with GlutaMAX™ (Gibco), 10% fetal bovine serum (FBS) (Gibco), and 100 U/mL penicillin-streptomycin (Fisher Scientific) onto Poly-L-ornithine hydrobromide (Sigma-Aldrich)-coated six-well culture plates (Corning) for Western blot analysis (1.0 × 10⁶ cells/mL), 12-mm glass coverslips (Marienfeld Superior) for immunocytochemistry (5.0 × 10⁵ cells/mL), or 35-mm four-well confocal dishes (SPL) for propidium iodide (PI) staining (5.0 × 10⁵ cells/mL). After 3 hours, the culture medium was replaced with B-27™ Plus Neuronal Culture System (Thermo Fisher) supplemented with 10% FBS and 100 U/mL penicillin-streptomycin. To prevent glial cell proliferation, neurons were treated with glial cell inhibitor, 1 μM Ara-C (Sigma). The medium was half-changed with fresh three times a week. At days in vitro (DIV) 7, cells were treated with 1 μg/mL of each peptides together 5 μg/mL PFF for Western blot analysis and immunocytochemistry or 10 μg/mL PFF for cell viability assays. The experimental conditions for PFF concentration and treatment duration were based on preliminary optimization experiments and previously validated protocols to induce pathological α-synuclein aggregation. The PFF concentration settings were set as per the following previous study63.
Preparation of α-synuclein PFF
Full-length human α-synuclein proteins were expressed in E.coli BL21(DE3) transformed with pRK172-hSNCA construct. After incubation at 37 °C for 16 hours, bacterial cells were harvested by centrifugation at 6000 × g for 10 minutes. The bacterial pellet was resuspended in a high-salt buffer containing 750 mM NaCl, 10 mM Tris (pH 7.6), 1 mM EDTA, and 1 mM PMSF. The resuspended pellet was lysed by sonication for 30 minutes (10-second pulses on/off) at 37% amplitude, followed by boiling for 15 minutes and then centrifugation at 6,000 × g for 20 minutes. The resulting supernatant was subjected to sequential purification steps, including anion exchange, size-exclusion, and cation exchange chromatography. The purified α-synuclein monomers were stored at −80 °C until use. To prepare α-synuclein PFF, α-synuclein monomers (5 mg/mL) were incubated in PBS under continuous stirring with a magnetic stirrer (1000 rpm at 37 °C) for one week. The resulting α-synuclein aggregates were sonicated for 30 seconds (0.5-second pulses on/off) at 10% amplitude. The sonicated fibril fragments have been known as PFF and were added to primary neuronal cultures at a final concentration of 5 μg/mL or 10 μg/mL in neuronal media.
Triton X-100 soluble and insoluble fractionation
Soluble and insoluble protein fractions were prepared from SH-SY5Y cells and primary cortical neurons using sequential lysis buffers. For the soluble fraction, cells were incubated on ice for 30 minutes in a lysis buffer containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, and protease/phosphatase inhibitors. Cells were then lysed by sonication for 15 seconds (1-second pulses on/off) at 10% amplitude. The lysates were centrifuged at 15,000 rpm for 30 minutes at 4 °C, and the resulting supernatant, representing the soluble fraction, was collected. To remove remained soluble fracted proteins, the residual pellet was washed once with a threefold volume of buffer without protease inhibitors, followed by an additional centrifugation step. For the insoluble fraction, the remaining pellet was resuspended in TX-insoluble lysis buffer containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 2% SDS, and protease/phosphatase inhibitors. The same sonication and centrifugation steps were performed once more, and the resulting supernatant, representing the insoluble fraction, was collected.
Cytoplasmic and nuclear fractionation
Cytoplasmic and nuclear lysates were prepared from SH-SY5Y cells using sequential lysis buffers. For the cytoplasmic fraction, cells were incubated on ice for 30 minutes in a lysis buffer containing 10 mM HEPES (pH 7.6), 3 mM MgCl₂, 40 mM KCl, 2 mM DTT, 5% glycerol, 0.5% NP-40, 0.5 mM PMSF, and protease/phosphatase inhibitors. The lysates were centrifuged at 3500 rpm for 5 minutes, and the resulting supernatant, representing the cytoplasmic fraction, was collected. The residual pellet was washed once with the cytoplasmic fraction buffer without protease inhibitors, followed by an additional centrifugation step. For the nuclear fraction, the remaining pellet was resuspended in a nuclear extraction buffer containing 10 mM HEPES (pH 7.9), 0.1 mM EGTA, 1.5 mM MgCl₂, 420 mM NaCl, 0.5 mM DTT, 0.5 mM PMSF, 25% glycerol, and protease/phosphatase inhibitors. The sample was incubated on ice for 20 minutes and centrifuged at 3500 rpm for 5 minutes. The resulting supernatant, representing the nuclear fraction, was collected.
NanoLuciferase assay
GBA1-HiBiT KI cells were plated onto 6-well plates. Peptides were then added at a final concentration of 1 μg/mL and incubated for 24 hours. Cells were pelleted by centrifugation at 3500 rpm for 5 minutes and resuspended in 200 μL of PBS by gentle pipetting. The cell suspension was transferred into a white 96-well plate. A mixture of PBS and Nano-Glo Luciferase Assay Substrate (Promega) was then added to each well at a 5:1 ratio, for a final volume of 120 μL per well. Luminescence was measured 30 minutes after substrate addition using a microplate reader (Infinite® 200 PRO, TECAN).
Western blotting analysis
Protein concentrations in cell lysates were determined using the BCA assay (Pierce™ BCA Protein Assay Kit, Thermo Fisher Scientific). 10 μg protein lysates were loaded onto 12% or 15% gradient SDS-PAGE gels, separated by electrophoresis, and subsequently transferred onto nitrocellulose membranes (0.45 μm pore size, Millipore). Membranes were blocked with 5% skim milk or 5% BSA in TTBS buffer containing 0.1% Tween 20 (Sigma) at room temperature for 30 minutes. The membrane was incubated overnight at 4 °C with primary antibodies; anti-GBA1 (1:1,000, Abnova, Cat#H00002629-M01), anti-GFP (1:3,000, Santa Cruz, Cat#sc-9996), anti-pS129 α-syn (1:3,000, Cell Signaling, Cat#23706S), anti-α-syn (1:1,000, BD Biosciences, Cat#610787), anti-Lamin B (1:1,000, Abcam, Cat#ab16048), anti-α-tubulin (1:6,000, Sigma, Cat#T9026), and anti-TFEB (1:1000, Cell signaling, Cat#4240). After primary antibody incubation, the membrane was washed three times with TBST, each for 10 minutes. Subsequently, the membrane was incubated for 1 hour at room temperature with HRP-conjugated secondary antibodies: HRP-conjugated rabbit secondary antibody (1:3000, Cell Signaling, Cat#7074S) and HRP-conjugated mouse secondary antibody (1:5000, Cell Signaling, Cat#7076S). Following secondary antibody incubation, the membrane was again washed four times with TBST, each for 10 minutes. Immunoblot signals were detected using the enhanced chemiluminescence (ECL) method with a ChemiDoc Imaging System (Bio-Rad) and Clarity Western ECL substrate (Bio-Rad). For reprobing, membranes were washed with Restore™ Plus Stripping Buffer (Thermo Fisher Scientific) and incubated with HRP-conjugated anti-β-actin antibody (1:20,000, Sigma Aldrich, Cat#A3854-200UL) at room temperature for 20 minutes.
Immunocytochemistry
Primary cortical neuronal cells were cultured on coverslips for one week, followed by PFF treatment to induce α-synuclein aggregate formation for an additional two weeks. SH-SY5Y and HEK293T cells were plated on coverslips and grown until they reached 50–60% confluence. Transfected cells were maintained for 24 hours. For immunostaining, cells were washed once with PBS (pH 7.4) and subsequently fixed with 4% paraformaldehyde for 15 minutes at room temperature. After fixation, cells were permeabilized with 0.1% Triton X-100 (Sigma) in PBS for 15 minutes at room temperature, followed by blocking in a solution containing 2% bovine serum albumin (BSA), 5% normal donkey serum (Jackson ImmunoResearch), and 0.1% Triton X-100 in PBS for 30 minutes at room temperature. Cells were then incubated overnight at 4 °C with primary antibodies diluted in blocking solution: anti-pSer129 α-synuclein (1:1,000, Cat#825701, anti-mouse IgG), anti-MAP2 (1:500, Cat#AB5622), anti-GBA1 (1:1,000, Abnova, Cat#H00002629-M01), and anti-LAMP1 (1:1,000, Cat#9091S). For the GlcCer immunostaining, fixed cells were permeabilized with 25 μg/mL digitonin in PBS for 15 minutes at room temperature. Cells were then incubated overnight at 4 °C with primary antibodies diluted in a solution containing 2% bovine serum albumin (BSA) and 5% normal donkey serum (Jackson ImmunoResearch) in PBS: anti-GlcCer (1:150, Cedarlane, Cat#RAS0011). Following three 10-minute washes with PBS, cells were incubated for 1 hour at room temperature with secondary antibodies diluted in blocking solution: Alexa Fluor™ Plus 488 anti-mouse IgG (1:500, Invitrogen, Cat#A32723) and Alexa Fluor™ 568 anti-rabbit IgG (1:500, Invitrogen, Cat#A11011). After three additional 10-minute washes with PBS, slides were mounted using mounting medium containing DAPI (VECTASHIELD). Fluorescent images were acquired using a Zeiss LSM 900 confocal microscope and processed with Zeiss Zen software. Image analysis was performed using ImageJ.
Lysosomal GCase activity assay
Lysosomal glucocerebrosidase (GCase) activity was measured using the fluorogenic substrate 4-methylumbelliferyl-β-D-glucopyranoside (4-MUG). Cell pellets were homogenized in homogenization buffer containing 0.25 M sucrose, 10 mM HEPES (pH 7.4), and 1 mM EDTA and centrifuged at 6800 × g for 5 minutes at 4 °C. The supernatant was transferred to a new e-tube and centrifuged at 17,000 × g for 10 minutes at 4 °C. The resulting pellet was resuspended in enzyme activity buffer containing 0.25% Triton X-100, 0.25% taurocholic acid, 1 µM EDTA, and 0.2 M citric acid/phosphate buffer (pH 5.4; 0.2 M sodium phosphate and 0.1 M citric acid). Samples were subjected to three freeze-thaw cycles and incubated on ice for 30 minutes to ensure complete lysis. Lysates were centrifuged at 20,000 × g for 20 minutes at 4 °C, and the supernatant was collected. Protein concentration was determined using the BCA assay. For the enzyme reaction, 10 µL of protein lysate (diluted in enzyme activity buffer) was mixed with 10 mM conduritol B epoxide (CBE) or distilled water. After gentle pipetting, 35 µL of 1 mM 4-MUG (diluted in 1% BSA) was added, making a final reaction volume of 50 µL. The mixture was incubated at 37 °C for 40 minutes, followed by the addition of 50 µL of 1 M glycine stop solution. Fluorescence intensity of 4-MUG was measured using a microplate reader (excitation: 355 nm, emission: 460 nm).
Cell viability assay
Primary cortical neuronal cells were seeded onto Poly-L-ornithine hydrobromide-coated 96-well plates at a density of 5.0 × 10⁵ cells/mL. At DIV 7, half of the medium was replaced with fresh medium containing 10 μg/mL PFF or PBS. Cells were incubated for two weeks after PFF treatment, with medium changes performed three times per week. To assess cell viability, cells were treated with AlamarBlue™ Cell Viability Reagent (1:10 dilution, Thermo Fisher Scientific) and incubated at 37 °C for 4 hours. Absorbance was measured at 570 nm and 600 nm using a microplate reader (Infinite® 200 PRO, TECAN), and viability was determined by calculating the difference between these values. For propidium iodide (PI) Staining, neurons cultured on poly-D-lysine-coated confocal dishes were incubated with PI staining solution (2 µM PI and 7 µM Hoechst33342 (Invitrogen)) for 5 minutes at 37 °C in the dark. After incubation, cells were washed three times with 1X PBS to remove excess dye. Imaging was carried out using a Zeiss Confocal LSM 900 microscope. The percentage of PI-positive cells was quantified relative to the total number of Hoechst-stained nuclei in at six randomly selected fields per sample.
RNA extraction and quantitative real-time PCR (RT-qPCR)
Total RNA was extracted from cell using the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions. For cDNA synthesis, 1 µg of total RNA was reverse-transcribed using the PrimeScript™ RT Master Mix (Perfect Real time) (Takara) in a total reaction volume of 10 µL. The reverse transcription program was as follows: lid temperature at 105 °C, reverse transcription at 37 °C for 15 minutes, enzyme inactivation at 85 °C for 5 seconds, and a final hold at 4 °C for 10 minutes. RT-qPCR was performed using SYBR™ Green PCR Master Mix (Applied Biosystems™) on a QuantStudio Real-Time PCR system, with thermal cycling conditions set as follows: initial denaturation at 95 °C for 10 minutes, followed by 40 cycles of denaturation at 95 °C for 15 seconds and annealing/extension at 60 °C for 1 minute. A melt curve analysis was performed with the following steps: 95 °C for 15 seconds, 60 °C for 1 minutes, and 95 °C for 1 second. Data were analyzed using the QuantStudio Design & Analysis Software v1.5.2. The primer sequences used were as follows: hTFEB forward: 5′-CCA GAA GCG AGA GCT CAC AGA T-3′ hTFEB reverse: 5′-TGT GAT TGT CTT TCT TCT GCC G-3′.
CHX chasing assay
HEK293T cells were seeded onto 6-well plates at a density of 1.0 × 10⁶ cells/mL. The culture medium was replaced with fresh medium containing 100 µg/mL cycloheximide (CHX). Cells were harvested at 0, 3, 6, and 9 hours after CHX treatment. For protein extraction, cells were lysed in RIPA buffer containing freshly added protease inhibitors per well. Lysates were subjected to sonication for 15 seconds (1-second pulse on/off) at 10% amplitude, followed by centrifugation at 12,000 rpm for 30 minutes at 4 °C. The resulting supernatant was collected, and protein concentration was determined using the BCA assay and then subjected to Western blotting.
Statistical analysis
Statistical analyses were performed with GraphPad Prism Software, version 10. Data were presented as mean ± standard error of the mean (SEM) unless otherwise indicated. One-way ANOVA followed by Tukey’s post-hoc test was used to analyze quantification for α-synuclein, phosphorylated α-synuclein (pS129 α-syn) and GBA1 protein levels. One-way ANOVA with Dunnett’s post-hoc test was used for luminescence intensity comparisons across peptide screening groups. Two-way ANOVA followed by Bonferroni post-hoc test was used to analyzed quantification for α-synuclein, phosphorylated α-synuclein (pS129 α-syn) and GBA1 protein, cell viability (AlamarBlue assay, PI staining), GCase enzymatic activity, CHX chasing assay and immunocytochemical quantifications of pS129 α-syn, GCase, and GlcCer. Two-tailed unpaired Student’s t-test was applied to analyze the nuclear-to-cytoplasmic ratio of TFEB protein and quantification of TFEB protein levels, TFEB mRNA levels and cellular TFEB levels. p-value < 0.05 were considered statistically significant.
Data availability
The authors affirm that data supporting the findings of this study included in this manuscript are reasonably available from the corresponding author upon request.
References
Poewe, W. et al. Parkinson disease. Nat. Rev. Dis. Prim. 3, 17013 (2017).
Sidransky, E. et al. Multicenter analysis of glucocerebrosidase mutations in Parkinson’s disease. N. Engl. J. Med 361, 1651–1661 (2009).
Manning-Bog, A. B., Schule, B. & Langston, J. W. Alpha-synuclein-glucocerebrosidase interactions in pharmacological Gaucher models: a biological link between Gaucher disease and parkinsonism. Neurotoxicology 30, 1127–1132 (2009).
Murphy, K. E. et al. Reduced glucocerebrosidase is associated with increased alpha-synuclein in sporadic Parkinson’s disease. Brain 137, 834–848 (2014).
Fulci, V. et al. Characterization of B- and T-lineage acute lymphoblastic leukemia by integrated analysis of MicroRNA and mRNA expression profiles. Genes Chromosomes Cancer 48, 1069–1082 (2009).
Mazzulli, J. R. et al. Gaucher disease glucocerebrosidase and alpha-synuclein form a bidirectional pathogenic loop in synucleinopathies. Cell 146, 37–52 (2011).
Yap, T. L., Velayati, A., Sidransky, E. & Lee, J. C. Membrane-bound alpha-synuclein interacts with glucocerebrosidase and inhibits enzyme activity. Mol. Genet Metab. 108, 56–64 (2013).
Gegg, M. E. et al. Glucocerebrosidase deficiency in substantia nigra of parkinson disease brains. Ann. Neurol. 72, 455–463 (2012).
Rocha, E. M. et al. Progressive decline of glucocerebrosidase in aging and Parkinson’s disease. Ann. Clin. Transl. Neurol. 2, 433–438 (2015).
Alcalay, R. N. et al. Glucocerebrosidase activity in Parkinson’s disease with and without GBA mutations. Brain 138, 2648–2658 (2015).
Gegg, M. E. & Schapira, A. H. V. The role of glucocerebrosidase in Parkinson disease pathogenesis. FEBS J. 285, 3591–3603 (2018).
Vitner, E. B., Farfel-Becker, T., Eilam, R., Biton, I. & Futerman, A. H. Contribution of brain inflammation to neuronal cell death in neuronopathic forms of Gaucher’s disease. Brain 135, 1724–1735 (2012).
Fernandes, H. J. et al. ER stress and autophagic perturbations lead to elevated extracellular alpha-synuclein in GBA-N370S Parkinson’s iPSC-derived dopamine neurons. Stem Cell Rep. 6, 342–356 (2016).
Clark, L. N. et al. Mutations in the glucocerebrosidase gene are associated with early-onset Parkinson disease. Neurology 69, 1270–1277 (2007).
Brockmann, K. et al. GBA-associated Parkinson’s disease: reduced survival and more rapid progression in a prospective longitudinal study. Mov. Disord. 30, 407–411 (2015).
Alcalay, R. N. et al. Cognitive performance of GBA mutation carriers with early-onset PD: the CORE-PD study. Neurology 78, 1434–1440 (2012).
Mazzulli, J. R. et al. Activation of beta-Glucocerebrosidase Reduces Pathological alpha-Synuclein and Restores Lysosomal Function in Parkinson’s Patient Midbrain Neurons. J. Neurosci. 36, 7693–7706 (2016).
Burbulla, L. F. et al. A modulator of wild-type glucocerebrosidase improves pathogenic phenotypes in dopaminergic neuronal models of Parkinson’s disease. Sci. Transl. Med 11, eaau6870 (2019).
Kopytova, A. E. et al. Ambroxol increases glucocerebrosidase (GCase) activity and restores GCase translocation in primary patient-derived macrophages in Gaucher disease and Parkinsonism. Parkinsonism Relat. Disord. 84, 112–121 (2021).
Sardi, S. P. et al. CNS expression of glucocerebrosidase corrects alpha-synuclein pathology and memory in a mouse model of Gaucher-related synucleinopathy. Proc. Natl Acad. Sci. USA 108, 12101–12106 (2011).
Huh, Y. E., Usnich, T., Scherzer, C. R., Klein, C. & Chung, S. J. GBA1 variants and Parkinson’s disease: paving the way for targeted therapy. J. Mov. Disord. 16, 261–278 (2023).
Lieberman, R. L. et al. Structure of acid beta-glucosidase with pharmacological chaperone provides insight into Gaucher disease. Nat. Chem. Biol. 3, 101–107 (2007).
Schapira, A. H. & Gegg, M. E. Glucocerebrosidase in the pathogenesis and treatment of Parkinson disease. Proc. Natl Acad. Sci. USA 110, 3214–3215 (2013).
Barton, N. W. et al. Replacement therapy for inherited enzyme deficiency–macrophage-targeted glucocerebrosidase for Gaucher’s disease. N. Engl. J. Med 324, 1464–1470 (1991).
Gehrlein, A. et al. Targeting neuronal lysosomal dysfunction caused by beta-glucocerebrosidase deficiency with an enzyme-based brain shuttle construct. Nat. Commun. 14, 2057 (2023).
Bendikov-Bar, I., Maor, G., Filocamo, M. & Horowitz, M. Ambroxol as a pharmacological chaperone for mutant glucocerebrosidase. Blood Cells Mol. Dis. 50, 141–145 (2013).
Mullin, S. et al. Ambroxol for the treatment of patients with Parkinson disease with and without glucocerebrosidase gene mutations: a nonrandomized, noncontrolled trial. JAMA Neurol. 77, 427–434 (2020).
Maegawa, G. H. et al. Identification and characterization of ambroxol as an enzyme enhancement agent for Gaucher disease. J. Biol. Chem. 284, 23502–23516 (2009).
Narita, A. et al. Ambroxol chaperone therapy for neuronopathic Gaucher disease: A pilot study. Ann. Clin. Transl. Neurol. 3, 200–215 (2016).
Yang, C. et al. Histone deacetylase inhibitors increase glucocerebrosidase activity in Gaucher disease by modulation of molecular chaperones. Proc. Natl Acad. Sci. USA 110, 966–971 (2013).
Morabito, G. et al. AAV-PHP.B-mediated global-scale expression in the mouse nervous system enables GBA1 gene therapy for wide protection from synucleinopathy. Mol. Ther. 25, 2727–2742 (2017).
Rocha, E. M. et al. Glucocerebrosidase gene therapy prevents alpha-synucleinopathy of midbrain dopamine neurons. Neurobiol. Dis. 82, 495–503 (2015).
Sardi, S. P. et al. Augmenting CNS glucocerebrosidase activity as a therapeutic strategy for parkinsonism and other Gaucher-related synucleinopathies. Proc. Natl Acad. Sci. USA 110, 3537–3542 (2013).
Lu, J. et al. Histone deacetylase inhibitors prevent the degradation and restore the activity of glucocerebrosidase in Gaucher disease. Proc. Natl Acad. Sci. USA 108, 21200–21205 (2011).
Ho, M. W. & O’Brien, J. S. Gaucher’s disease: deficiency of ‘acid’ -glucosidase and reconstitution of enzyme activity in vitro. Proc. Natl Acad. Sci. USA 68, 2810–2813 (1971).
Belmatoug, N. et al. Management and monitoring recommendations for the use of eliglustat in adults with type 1 Gaucher disease in Europe. Eur. J. Intern Med 37, 25–32 (2017).
Platt, F. M. Emptying the stores: lysosomal diseases and therapeutic strategies. Nat. Rev. Drug Discov. 17, 133–150 (2018).
Sardi, S. P. et al. Glucosylceramide synthase inhibition alleviates aberrations in synucleinopathy models. Proc. Natl Acad. Sci. USA 114, 2699–2704 (2017).
Viel, C. et al. Preclinical pharmacology of glucosylceramide synthase inhibitor venglustat in a GBA-related synucleinopathy model. Sci. Rep. 11, 20945 (2021).
Giladi, N. et al. Safety and efficacy of venglustat in GBA1-associated Parkinson’s disease: an international, multicentre, double-blind, randomised, placebo-controlled, phase 2 trial. Lancet Neurol. 22, 661–671 (2023).
Williams, D. et al. High-throughput screening for small-molecule stabilizers of misfolded glucocerebrosidase in Gaucher disease and Parkinson’s disease. Proc. Natl Acad. Sci. USA 121, e2406009121 (2024).
Machtel, R., Boros, F. A., Dobert, J. P., Arnold, P. & Zunke, F. From lysosomal storage disorders to parkinson’s disease - challenges and opportunities. J. Mol. Biol. 435, 167932 (2023).
Zhang, X., Wu, H., Tang, B. & Guo, J. Clinical, mechanistic, biomarker, and therapeutic advances in GBA1-associated Parkinson’s disease. Transl. Neurodegener. 13, 48 (2024).
Zou, L. L., Ma, J. L., Wang, T., Yang, T. B. & Liu, C. B. Cell-penetrating Peptide-mediated therapeutic molecule delivery into the central nervous system. Curr. Neuropharmacol. 11, 197–208 (2013).
Keighron, C. N. et al. Extracellular vesicles, cell-penetrating peptides and miRNAs as future novel therapeutic interventions for Parkinson’s and Alzheimer’s disease. Biomedicines 11, 728 (2023).
Dixon, A. S. et al. NanoLuc complementation reporter optimized for accurate measurement of protein interactions in cells. ACS Chem. Biol. 11, 400–408 (2016).
Hall, M. P. et al. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 7, 1848–1857 (2012).
Settembre, C. et al. TFEB links autophagy to lysosomal biogenesis. Science 332, 1429–1433 (2011).
Sardiello, M. et al. A gene network regulating lysosomal biogenesis and function. Science 325, 473–477 (2009).
Kumar, S. D. et al. Novel leech antimicrobial peptides, hirunipins: real-time 3D monitoring of antimicrobial and antibiofilm mechanisms using optical diffraction tomography. Adv. Sci. (Weinh.) 12, e2409803 (2025).
Abeliovich, A., Hefti, F. & Sevigny, J. Gene therapy for Parkinson’s disease associated with GBA1 mutations. J. Parkinsons Dis. 11, S183–S188 (2021).
Arthur, C. J. et al. Structure and malonyl CoA-ACP transacylase binding of streptomyces coelicolor fatty acid synthase acyl carrier protein. ACS Chem. Biol. 4, 625–636 (2009).
Dehay, B. et al. Lysosomal impairment in Parkinson’s disease. Mov. Disord. 28, 725–732 (2013).
Moors, T. et al. Lysosomal dysfunction and alpha-synuclein aggregation in Parkinson’s disease: diagnostic links. Mov. Disord. 31, 791–801 (2016).
Pignatelli, M., Durbin, H. & Bodmer, W. F. Carcinoembryonic antigen functions as an accessory adhesion molecule mediating colon epithelial cell-collagen interactions. Proc. Natl Acad. Sci. USA 87, 1541–1545 (1990).
Cortes, C. J. & La Spada, A. R. TFEB dysregulation as a driver of autophagy dysfunction in neurodegenerative disease: Molecular mechanisms, cellular processes, and emerging therapeutic opportunities. Neurobiol. Dis. 122, 83–93 (2019).
Napolitano, G. & Ballabio, A. TFEB at a glance. J. Cell Sci. 129, 2475–2481 (2016).
Huber, L. A. & Teis, D. Lysosomal signaling in control of degradation pathways. Curr. Opin. Cell Biol. 39, 8–14 (2016).
Geuze, H. J., Slot, J. W., Strous, G. J., Hasilik, A. & von Figura, K. Possible pathways for lysosomal enzyme delivery. J. Cell Biol. 101, 2253–2262 (1985).
Martini-Stoica, H., Xu, Y., Ballabio, A. & Zheng, H. The autophagy-lysosomal pathway in neurodegeneration: a TFEB perspective. Trends Neurosci. 39, 221–234 (2016).
Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308 (2013).
Luk, K. C. et al. Exogenous alpha-synuclein fibrils seed the formation of Lewy body-like intracellular inclusions in cultured cells. Proc. Natl Acad. Sci. USA 106, 20051–20056 (2009).
Volpicelli-Daley, L. A., Luk, K. C. & Lee, V. M. Addition of exogenous alpha-synuclein preformed fibrils to primary neuronal cultures to seed recruitment of endogenous alpha-synuclein to Lewy body and Lewy neurite-like aggregates. Nat. Protoc. 9, 2135–2146 (2014).
Acknowledgements
This work was supported by grants from the National Research Foundation of Korea (NRF)-RS-2022-NR072007 and Global - Learning & Academic research institution for Master’s·PhD students, and Postdocs (LAMP) Program (NRF-RS-2024-00445180).
Author information
Author notes
These authors contributed equally: Sung-Jin Cho, Sangjune Kim.
Authors and Affiliations
Department of Biological Sciences and Biotechnology, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea
Hyerynn Kim, Jiyeon Na, Hye Guk Ryu, Eunmin Lee, Hyeonwoo Park, Haeun Park, Younwoo Nam, Geon-Hwi Jeong, In-Hyeok Pyo, Jun-Ho Song, Sung-Jin Cho & Sangjune Kim
Department of Biochemistry, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea
Jung-Hyun Choi, Jihoon Nah & Sang-Min Jang
Authors
- Hyerynn Kim
- Jiyeon Na
- Hye Guk Ryu
- Eunmin Lee
- Hyeonwoo Park
- Haeun Park
- Younwoo Nam
- Geon-Hwi Jeong
- In-Hyeok Pyo
- Jung-Hyun Choi
- Jihoon Nah
- Sang-Min Jang
- Jun-Ho Song
- Sung-Jin Cho
- Sangjune Kim
Contributions
H.K. performed most experiments, data analysis, and co-wrote the manuscript with S.K. J.Na. and H.G.R. generated GBA1-HiBiT cell line. E.L. and Hyeonwoo.P. generated recombinant α-synuclein monomers and prepared preformed fibrils. Haeun.P. and Y.N. maintained cell lines and analyzed fluorescent imaging. G-.H.J. and I-.H.P. prepared leech peptides. J.-H.C., J.Nah., S-.M.J., and J-.H.S. provided DNA constructs, analyzed preliminary data and edited manuscript. S-.J.C. and S.K. contributed experimental analytical design, supervision, data analysis and co-wrote the manuscript.
Corresponding authors
Correspondence to Sung-Jin Cho or Sangjune Kim.
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Kim, H., Na, J., Ryu, H.G. et al. A novel peptide-based strategy to enhance GBA1 expression for treating Parkinson’s disease. npj Parkinsons Dis. 11, 323 (2025). https://doi.org/10.1038/s41531-025-01175-w
Received: 19 May 2025
Accepted: 08 October 2025
Published: 19 November 2025
Version of record: 19 November 2025
DOI: https://doi.org/10.1038/s41531-025-01175-w